• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The present disclosure provides a DNA barcode for identifying Repomucenus olidus and Repomucenus virgis, an identification method and application thereof, and belongs to the technical field of biology. In the present disclosure, the R. o/idus has a DNA barcode 5 sequence shown as SEQ ID No. 1; the R. virgis has a DNA barcode sequence shown as SEQ ID No. 2. Primers for amplifying the DNA barcode include 12S-MiFish-F and 12S- MiFish-R; the method includes the following steps: extracting genomic DNA from a sample to be identified; using the primers to amplify the DNA to be identified; aligning a sequence of an amplified product with the DNA barcode; and determining the species of the sample 10 to be identified. Identification of R. o/idus and R. virgis by the DNA barcode provided by the present disclosure obtains stable results, with strong reproducibility.
    公开号:NL2027615A
    申请号:NL2027615
    申请日:2021-02-22
    公开日:2021-05-12
    发明作者:Yang Chaojie；Qiu Qingbo；Li Yang；Gao Wenxuan；Linghu Wenlong
    申请人:Univ Hainan Tropical Ocean；
    IPC主号:
    专利说明:

    DNA BARCODE FOR IDENTIFYING REPOMUCENUS OLIDUS AND REPOMUCENUS VIRGIS, IDENTIFICATION METHOD AND APPLICATION THEREOF
    TECHNICAL FIELD The present disclosure belongs to the technical field of molecular biology, and in particular relates to a DNA barcode for identifying Repomucenus olidus and Repomucenus virgis, an identification method and application thereof.
    BACKGROUND Repomucenus olidus (Gunther, 1873) belongs to the family Callionymidae under order Perciformes. R. olidus is a small, shallow, warm water bottom fish. The fish lives in estuary regions and coastal waters where rivers enters the sea, and also enters the lower reaches of rivers and attached water bodies thereof. The fish mainly feeds on phytoplankton and zooplankton, including diatoms, foraminifera, and tintinnids. R. olidus is distributed in the northwest Pacific Ocean, including China and the Korean Peninsula. In China, the fish is mainly distributed along the coasts of the East China Sea and the South China Sea, the lower reaches of various rivers, the offshore areas of Taiwan Province, and occasionally in the offshore waters and various estuaries of Jiangsu. The external morphology is similar to that of Repomucenus virgis (Jordan & Fowler, 1903): the body is elongate and longitudinally depressed. The occipital region is smooth. The gill aperture is dorsal. The preopercular spine is 0.36-0.42 times the head length. The strong spine is wide, the end is curved upwards, the ventral edge is smooth and straight or slightly convex, the base has a strong inverted spine, and the dorsal edge has 3-5 large processes (some specimens have two spines). The lateral line extends from the eye to the base of the caudal fin and has a short subocular branch. The lateral line usually has a plurality of very short downward branches. The occipital region and the dorsal caudal peduncle individually have a transverse lateral line connecting the two lateral lines of the body. The base of the first dorsal fin is short, shorter than the distance between two dorsal fins. The first dorsal fin is slightly higher in males, and the first spine is the longest, which is as high as the second dorsal fin. The first dorsal fin is lower in females. The edge of the second dorsal fin is straight or slightly concave in females and males; the fin rays of dorsal and anal fins are not furcate except the last fin ray; the pectoral fin extends to the base of the first or second anal fin of the anal fin; the caudal fin is rounded. As shown in a specimen preserved in alcohol, the body is brown to dark brown, and the abdomen and throat are brown; the eyes are dark gray; the head and body have a plurality of dark spots and dark stripes; the first dorsal fin membrane is black in females and pale in males; the second dorsal fin is transparent in both sexes, usually with a black spot on the base of each fin ray; the anal fin is transparent; the base of the caudal fin has 1 or 2 rows of vertical spots. Although there are certain differences in the length of dorsal fin rays between R. olidus and R. virgis, both of them are typical small fishes and are very similar in a plurality of morphological characteristics, but morphological characteristics alone may easily lead to misidentification. Therefore, it is an important issue to seek a reliable standard to distinguish between R. olidus and R. virgis, identify and isolate samples from mixed individuals.
    SUMMARY In view of this, an objective of the present disclosure is to provide a DNA barcode for identifying R. olidus and R. virgis, an identification method and application thereof. The present disclosure uses a minimalist DNA barcode to identify two Repomucenus species, and the method is simple to operate, easy to master, and highly accurate; the present disclosure helps solve the problem of confounding germplasm, and provides technical support for research on fish taxonomy and fish diversity protection. To achieve the above objective of the present disclosure, the present disclosure provides the following technical solutions: The present disclosure provides a DNA barcode for identifying R. olidus and R. virgis, where the R. olidus has a DNA barcode sequence shown as SEQ ID No. 1; the R. virgis has a DNA barcode sequence shown as SEQ ID No. 2. The present disclosure provides primers for amplifying the DNA barcode, including 12S-MiFish-F and 12S-MiFish-R; the 12S-MiFish-F has a nucleotide sequence shown as SEQ ID No. 3; the 12S-MiFish-R has a nucleotide sequence shown as SEQ ID No. 4. The present disclosure provides a method for using the DNA barcode to identify R. olidus and R. virgis, including the following steps of: step 1, extracting genomic DNA from a sample to be identified to obtain DNA to be identified; step 2, using the DNA to be identified obtained in step 1 as a template, and conducting PCR amplification with the primers to obtain an amplified product; and step 3, aligning a sequence of the amplified product with the DNA barcode, where the sample to be identified is R. olidus on the condition that the sequence of the amplified product is consistent with the DNA barcode of the R. olidus, and the sample to be identified is R. virgis on the condition that the sequence of the amplified product is consistent with the DNA barcode of the R. virgis.
    Preferably, a system of the PCR amplification in step 2 may be 25.15 pL and may include the following components: ultrapure water 17.5 pL, 10x buffer 2.5 pL, dNTPs 2 JL, rTaq 0.15 pL, DNA to be identified 1 pL, primer 12S-MiFish-F 1 HL, and primer 12S- MiFish-R 1 pL. Preferably, a program of the PCR amplification in step 2 may be as follows: initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 25 s, annealing at 54°C for 25 s, and extension at 72°C for 25 s; extension at 72°C for 8 min, and storage at 4°C. Preferably, the sequence of the amplified product in step 3 may be obtained by sequencing. The present disclosure further provides application of the DNA barcode for identifying R. olidus and R. virgis and the primers for amplifying the DNA barcode in identifying R. olidus and R. virgis. The present disclosure has the following beneficial effects: The DNA barcode for identifying R. ofidus and R. virgis provided by the present disclosure is located on the mitochondrial DNA (mtDNA) 12S rRNA; identification of R. olidus and R. virgis by the DNA barcode obtains stable results, with strong reproducibility; the identification method is simple.
    DETAILED DESCRIPTION The present disclosure provides a DNA barcode for identifying R. olidus and R. virgis, where the R. olidus has a DNA barcode sequence shown as SEQ ID No. 1; the R. virgis has a DNA barcode sequence shown as SEQ ID No. 2. In the present disclosure, the DNA barcode for identifying R. olidus and R. virgis is located on the mtDNA 12S rRNA. The R. olidus has a DNA barcode sequence shown as SEQ ID No. 1, specifically as follows:CACCGCGGTTATACGAGAGGCCCAAATTGACCTACAACGGCGTAAAGGGTGGTT
    AAAATTTACTAGAATAGAGCCGAACTGATCCCTGACTGTTATACGTTACGGAATAAAG AAGAACAATAAACGAAGGTAGCTCTAAAATTTTGAAACCACGAAAGCTAGGAAA,; the R. virgis has a DNA barcode sequence shown as SEQ ID No. 2, specifically as follows:CACCGCGGTTATACGAGAGGCCCAAATTGATAGGTACGGCGTAAAGGGTGGTTAAAATCTTATTAACCTAGGGCCGAACTCGTCCCCGACTGTTATACGTTACGGAATGAAG AAGTACTAAAACGAAAGTAGCTCTAAATATTTGAATCCACGAAAGCTAGGAAA.
    In the present disclosure, there are 22 base differences between the DNA barcode sequences of R. olidus and R. virgis, revealing 9 transversions, 8 transitions, and 5 insertions/deletions.
    The present disclosure provides primers for amplifying the DNA barcode, including 12S-MiFish-F and 12S-MiFish-R; the 12S-MiFish-F has a nucleotide sequence shown as SEQ ID No. 3, specifically as follows: 5'-GTTGGTAAAACTCGTGCCAGC-3'; the 12S- MiFish-R has a nucleotide sequence shown as SEQ ID No. 4, specifically as follows: 5'- CATAGTGGGGTATCTAATCCCAGTTTG-3'. The present disclosure further provides a method for using the DNA barcode to identify R. ofidus and R. virgis, including the following steps: step 1, extracting genomic DNA from a sample to be identified to obtain DNA to be identified; step 2, using the DNA to be identified obtained in step 1 as a template, and conducting PCR amplification with the primers to obtain an amplified product; and step 3, aligning a sequence of the amplified product with the DNA barcode; the sample to be identified is R. olidus on the condition that the sequence of the amplified product is consistent with the DNA barcode of the R. olidus, and the sample to be identified is R. virgis on the condition that the sequence of the amplified product is consistent with the DNA barcode of the R. virgis.
    In the present disclosure, the genomic DNA of the sample to be identified is first extracted to obtain the DNA to be identified.
    The present disclosure has no special limitation on the extraction method of the genomic DNA of the sample to be identified, as long as animal genomic DNA extraction methods conventional in the art may be used, and preferably, a commercial DNA extraction kit may be used for extraction.
    In the present disclosure, after the DNA to be identified, using the DNA to be identified as a template, PCR amplification is conducted with the primers to obtain an amplified product.
    In the present disclosure, a system of the PCR amplification may be 25.15 HL and may preferably include the following components: ultrapure water 17.5 HL, 10x buffer 2.5 UL, dNTPs 2 pL, rTaq 0.15 pL, DNA to be identified 1 HL, primer 12S-MiFish-F 1 HL, and primer 12S-MiFish-R 1 pL.
    In the present disclosure, a program of the amplification may preferably be as follows: initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 25 s, annealing at 54°C for 25 s, and extension at 72°C for 25 s; extension at 72°C for 8 min, and storage at 4°C.
    The present disclosure may preferably further include the step of purifying the amplified product after the PCR amplification is completed; the present disclosure has no special limitation on the method for purifying the amplified product, as long as a PCR purification kit conventional in the art may be used.
    In the present disclosure, after the purification step, it may be preferable to sequence the amplified product purified to obtain the sequence of the amplified product.
    The present disclosure has no special limitation on sequencing methods, and the conduct of sequencing may preferably be entrusted by a biological sequencing company.
    In the present disclosure, after obtaining the sequence of the amplified product, the sequence of the amplified product is aligned with the DNA barcode; the sample to be 5 identified is R. olidus on the condition that the sequence of the amplified product is consistent with the DNA barcode of the R. olidus; the sample to be identified is R. virgis on the condition that the sequence of the amplified product is consistent with the DNA barcode of the R. virgis.
    The present disclosure further provides application of the DNA barcode for identifying R. olidus and R. virgis and the primers for amplifying the DNA barcode in identifying R. olidus and R. virgis.
    The application of the DNA barcode for identifying R. olidus and R. virgis and the primers for amplifying the DNA barcodes provided by the present disclosure may achieve simple, fast and accurate identification of R. olidus and R. virgis.
    The technical solutions provided by the present disclosure will be described in detall below in conjunction with examples, but they should not be construed as limiting the protection scope of the present disclosure.
    Example 1 R. olidus and R. virgis from the offshore waters of Zhoushan, Zhejiang Province were selected to form a R. olidus sample group and a R. virgis sample group.
    Individual DNAs were extracted from the two sample groups, and the extracted DNAs were used as templates for PCR amplification; the amplification products were purified and sequenced, and the sequencing results were aligned; the primer sequences were: 12S-MiFish-F (SEQ ID No. 3): 5’- GTTGGTAAAACTCGTGCCAGC-3' and 12S-MiFish-R (SEQ ID No. 4): 5- CATAGTGGGGTATCTAATCCCAGTTTG-3'; a system of the PCR amplification was as follows: the following was added to a 0.2 mL centrifuge tube successively: ultrapure water 17.5 UL 10x buffer 2.5L dNTPs 2 pL rTaq 0.15 uL template 1 pL primers 12S-MiFish-F and 12S-MiFish-R 1 uL each;
    a program of the PCR amplification was as follows: initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 25 s, annealing at 54°C for 25 s, and extension at 72°C for 25 s; extension at 72°C for 8 min, and storage at 4°C for =.
    AxyPrep DNA Gel Extraction Kit was used to purify the PCR products. The specific purification steps were as follows: (1) an agarose gel containing the target DNA was cut under ultraviolet lamp, and a tissue was used to absorb the liquid on the gel surface thoroughly; the weight of a 1.5 ml centrifuge tube was recorded in advance, and the weight of the gel was calculated, which served as a gel volume (for example, 100 mg = 100 HL volume); (2) 3 gel volumes of Buffer DE-A was added, mixed well, heated at 75°C, and mixed intermittently (every 2-5 min) until the gel mass was completely melted (for about 6- 8 min); (3) 0.5 Buffer DE-A volume of Buffer DE-B was added, and mixed well; and 1 gel volume of isopropanol was added; (4) the mixture in step 3 was pipetted, transferred to a DNA preparation tube (placed in a 2 ml centrifuge tube), and centrifuged for 1 min at 12,000xg, and a filtrate was discarded; (5) the preparation tube was put back into the 2 ml centrifuge tube, 500 uL of Buffer W1 was added and centrifuged for 30 s at 12,000xg, and a filtrate was discarded; (6) the preparation tube was put back to the 2 ml centrifuge tube, 650 pL of Buffer W2 was added and centrifuged for 30 s at 12,000xg, and a filtrate was discarded; the mixture was washed again with 650 pL of Buffer W2 in the same manner, and centrifuged for 1 min at 12,000xg; (7) the preparation tube was put back into the 2 ml centrifuge tube, and centrifuged for 1 min at 12,000xg; (8) the preparation tube was placed in a clean 1.5 ml centrifuge tube, 25-30 pL of eluent or deionized water was added at the center of the prepared membrane, and left to stand for 1 min at room temperature. The DNA was eluted after centrifugation for 1 min at 12,000xg. The eluent was collected and sent to Shanghai Sunny Biotechnology Co., Ltd. for sequencing. ABI 3730XL DNA Sequencer was used as a sequencing platform. After sequencing, the sequencing results of the four groups were aligned.
    According to the 166 bp base sequencing results of the mtDNA 12S rRNA genes of R. olidus and R. virgis, it can be seen that there are 22 base differences between R. olidus and R. virgis, revealing 9 transversions, 8 transitions, and 5 insertions/deletions.
    The 166 bp sequence alignment results of the mtDNA 12S rRNA genes of R. olidus and R. virgis are shown in Table 1.
    Table 1 The 166 bp sequence alignment of mtDNA 12S rRNA genes of R. olidus and R. virgis
    ZSRO |CACCGCGGTT | ATACGAGAGG |CCCAAATTGA|CCTACA-ACG ZSRY [eeen GOTE ZSRO | GCGTAAAGGG | TGGTTAAAAT |-TTACTAGAA | TAGAGCCGAA ZSRO |CTGATCCCTG | ACTGTTATAC |GTTACGGAAT | AAAGAAGAAC ZSRO |AATAAACGAA | GGTAGCTCTA AAATTTTGAA | ACCACGAAAG ZSRO |CTAGGAAA| | Herein, "* indicates an identical base sequence locus, and "-" indicates a deletion locus. ZSRO: R. olidus sample from the offshore waters of Zhoushan; ZSRV: R. virgis sample from the offshore waters of Zhoushan. The sequencing results showed that the DNA barcode sequence of R. olidus was:CACCGCGGTTATACGAGAGGCCCAAATTGACCTACAACGGCGTAAAGGGTGGTTAAA
    ATTTACTAGAATAGAGCCGAACTGATCCCTGACTGTTATACGTTACGGAATAAAGAAG AACAATAAACGAAGGTAGCTCTAAAATTTTGAAACCACGAAAGCTAGGAAA; the DNA barcode sequences of R. virgis was:CACCGCGGTTATACGAGAGGCCCAAATTGATAGGTACGGCGTAAAGGGTGGTTAAAA
    TCTTATTAACCTAGGGCCGAACTCGTCCCCGACTGTTATACGTTACGGAATGAAGAAG TACTAAAACGAAAGTAGCTCTAAATATTTGAATCCACGAAAGCTAGGAAA. The amplification results of 5 R. olidus samples were consistent, and the results were stable and strongly reproducible. In summary, the amplification results show high consistency within the species R. olidus (Zhoushan population) provided by the present disclosure; the amplification results of R. virgis are significantly different from that of R. olidus. The DNA barcode based on the base difference of the 12S rRNA gene provided by the present disclosure can distinguish between R. olidus and R. virgis.
    The above is only the preferred example of the present disclosure; it should be noted that several improvements and modifications can also be made by those of ordinary skill in the art without departing from the principles of the present disclosure, and these improvements and modifications should also be regarded as the protection scope of the present disclosure.
    Sequence Listing <110> Hainan Tropical Ocean University <120> DNA BARCODE FOR IDENTIFYING REPOMUCENUS OLIDUS AND REPOMUCENUS VIRGIS, IDENTIFICATION METHOD AND APPLICATION THEREOF <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 166 <212> DNA <213> Artificial Sequence <400> 1 caccgcggtt atacgagagg cccaaattga cctacaacgg cgtaaagggt ggttaaaatt 60 tactagaata gagccgaact gatccctgac tgttatacgt tacggaataa agaagaacaa 120 taaacgaagg tagctctaaa attttgaaac cacgaaagct aggaaa 166 <210> 2 <211> 165 <212> DNA <213> Artificial Sequence <400> 2 caccgcggtt atacgagagg cccaaattga taggtacggc gtaaagggtg gttaaaatct 60 tattaaccta gggccgaact cgtccccgac tgttatacgt tacggaatga agaagtacta 120 aaacgaaagt agctctaaat atttgaatcc acgaaagcta ggaaa 165 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <400> 3 gttggtaaaa ctcgtgccag c 21 <210> 4 <211> 27 <212> DNA
    <213> Artificial Sequence <400> 4 catagtgggg tatctaatcc cagtttg 27SEQLTXT
    SEQUENCE LISTING <110> Hainan Tropical Ocean University <120> DNA BARCODE FOR IDENTIFYING REPOMUCENUS OLIDUS AND REPOMUCENUS VIRGIS, IDENTIFICATION METHOD AND APPLICATION THEREOF <130> P6100911NL <150> CN 202010881841.3 <151> 2020-08-28 <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 166 <212> DNA <213> Artificial sequence <220> <223> Repomucenus olidus DNA barcode <400> 1 caccgcggtt atacgagagg cccaaattga cctacaacgg cgtaaagggt ggttaaaatt 60 tactagaata gagccgaact gatccctgac tgttatacgt tacggaataa agaagaacaa 120 taaacgaagg tagctctaaa attttgaaac cacgaaagct aggaaa 166 <210> 2 <211> 165 <212> DNA <213> Artificial sequence <220> <223> Repomucenus virgis DNA barcode <400> 2 caccgcggtt atacgagagg cccaaattga taggtacggc gtaaagggtg gttaaaatct 60 tattaaccta gggccgaact cgtccccgac tgttatacgt tacggaatga agaagtacta 120 aaacgaaagt agctctaaat atttgaatcc acgaaagcta ggaaa 165 <210> 3 <211> 21 <212> DNA <213> Artificial sequence Pagina 1SEQLTXT
    <220>
    <223> 12S-MiFish-F
    <400> 3 gttggtaaaa ctcgtgccag c 21
    <210> 4
    <211> 27
    <212> DNA
    <213> Artificial sequence
    <220>
    <223> 12S-MiFish-R
    <400> 4 catagtgggg tatctaatcc cagtttg 27 Pagina 2
    权利要求:
    Claims (7)
    [1]
    A DNA barcode for identifying Repomucenus olidus and Repomucenus virgis, wherein the Repomucenus olidus has a DNA barcode sequence shown as SEQ ID NO. 1; and the Repomucenus virgis has a DNA barcode sequence shown as SEQ ID NO. 2.
    [2]
    Primers for amplifying the DNA barcode according to claim 1, comprising 12S-MiFish-F and 12S-MiFish-R; wherein the 12S-MiFish-F has a nucleotide sequence shown as SEQ ID NO. 3; and the 12S-MiFish-R has a nucleotide sequence shown as SEQ ID NO. 4.
    [3]
    A method of using the DNA barcode of claim 1 to identify Repomucenus olidus and Repomucenus virgis, comprising the steps of: step 1, extracting genomic DNA from a sample to be identified to obtain DNA to be identified; step 2, using the DNA obtained in step 1 to be identified as a template, and performing PCR amplification with the primers of claim 2 to obtain an amplified product; and step 3, aligning a sequence of the amplified product with the DNA barcode, wherein the sample to be identified is Repomucenus olidus provided that the sequence of the amplified product is consistent with the DNA barcode of the Repomucenus olidus, and the Sample to be identified Repomucenus virgis is provided that the sequence of the amplified product is consistent with the DNA barcode of the Repomucenus virgis.
    [4]
    The method of claim 3, wherein a system of the PCR amplification in step 2 is 25.15 pL and comprises the following components: ultrapure water 17.5 HL, 10x buffer 2.5 pL, dNTPs 2 L1, rTaq 0, 15 µL, DNA to be identified 1 µL, primer 12S-MiFish-F 1 µL, and primer 12S-MiFish-R 1 µL.
    [5]
    The method of claim 3 or 4, wherein a program of the PCR amplification in step 2 is as follows: initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 25 s, annealing at 54°C for 25 s, and extension at 72°C for 25 s; extension at 72°C for 8 min, and storage at 4°C.
    [6]
    The method of claim 3, wherein the sequence of the amplified product 40 in step 3 is obtained by sequencing.
    [7]
    Use of the DNA barcode for identifying Repomucenus olidus and Repomucenus virgis according to claim 1 and the primers for amplifying the DNA barcode according to claim 2 in identifying Repomucenus olidus and Repomucenus virgis.
    类似技术:
    公开号 | 公开日 | 专利标题
    JPWO2003072775A1|2005-06-23|Algae-derived promoters, introns and terminators
    CN108841945B|2020-05-05|PCR amplification primer, method and kit for rapidly identifying genetic sex of Chinese softshell turtles
    CN105821054B|2019-12-13|sinkiang bream DNA bar code standard detection sequence and application thereof
    CN105018483A|2015-11-04|DOCK2 gene fragment used as molecular marker for detecting immune character of pig and application of DOCK2 gene fragment
    WO2020253630A1|2020-12-24|Polynucleotide for identifying male or female plant of ginkgo and use thereof
    CN102719545A|2012-10-10|Identification method of cattle excellent superovulation character molecular marker by hypoxia-inducible factor and application thereof
    NL2027615B1|2021-11-16|Dna barcode for identifying repomucenus olidus and repomucenus virgis, identification method and application thereof
    KR101940286B1|2019-01-23|Primer Set for Identifying Maternal origin of Ilex x wandoensis and Uses Thereof
    CN107815498B|2020-05-05|SNP molecular marker related to multiple economic traits of pig and application thereof
    Koh et al.2009|Two sympatric phylogroups of the Chinese water deer | identified by mitochondrial DNA control region and cytochrome b gene analyses
    CN102876777B|2015-09-09|The special primer of brown croaker EST microsatellite marker and screening method
    CN102134600B|2012-08-22|PCR | method for sex appraisal of Nipponia nippon
    CN106636319A|2017-05-10|Molecular biological method for rapidly identifying Hoolock leuconedys and Nomascus leucogenys
    CN106591426A|2017-04-26|COI gene standard complete sequence and molecular identification method of hoolock leuconedys
    CN111057771B|2021-10-19|SNP molecular marker for distinguishing &#39;Zhongyang No. 1&#39; from common fugu obscurus and application thereof
    KR100913941B1|2009-08-25|Korean native pig specific DNA markers and method for detecting Korean native pig using the markers
    Mohasseb et al.2009|Sex determination of Jojoba using RAPD markers and Sry gene primer combined with RAPD primers
    CN108531620B|2021-10-29|Primer and method for identifying acipenser schrencki, acipenser sibiricus and filial generation thereof
    RU2748590C1|2021-05-27|Method for detecting and identifying trematoda partenitis | in past-feather molluscs of the lymnaeidae family
    JP2021061826A|2021-04-22|Combination of female scallop-specific molecule markers and application thereof
    CN108192984B|2020-06-23|Molecular marker related to Hu sheep meat quality character, specific primer pair and application
    CN108660223B|2021-10-29|Siberian sturgeon and identification method of Siberian sturgeon
    KR101929340B1|2018-12-17|The primer set for determining Apis mellifera species using analysis of single nucleotide polymorphism or composition comprising thereof
    CN111926087A|2020-11-13|DNA bar code for identifying unscheduled sp of flatfish and flatfish with transverse band, and identification method and application thereof
    CN113249497A|2021-08-13|SNP molecular marker related to growth traits of mandarin fish, primer and application
    同族专利:
    公开号 | 公开日
    NL2027615B1|2021-11-16|
    CN111944909A|2020-11-17|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    法律状态:
    优先权:
    申请号 | 申请日 | 专利标题
    CN202010881841.3A|CN111944909A|2020-08-28|2020-08-28|DNA bar code for identifying ramose scouring spine and ramose scouring spine as well as identification method and application thereof|
    [返回顶部]